Saturday, July 04, 2009
Calendar | Directory | Career Opportunities
The Rockefeller University Home Page
Search
Advanced Search
Genomics Resource Center
Welcome
Services »
Instruments
Pricing
Service Request Page
Protocols
Sample Prep and QC
Links
Contact Us

Home  >  Resource Centers  >  Genomics Resource Center  >  Services
Print
PRINT
Solexa Sequencing

Applications

The Illumina Genome Analyzer (also referred to as Solexa) is available for use in many applications, including but not limited to:

  • Whole genome shotgun sequencing for SNP detection
  • ChIP-Seq
  • Small RNA discovery/expression
  • Digital gene expression

As there are many types of applications it is essential that you speak with us regarding the specific goals and technical aspects of your research projects.

Service and Sample Submission

All users are required to fill the Sample Submission Form and email it to us genomics@rockefeller.edu

We can sequence up to 8 samples in a run. You can submit any number of samples and use any number of lanes, as we can combine different users' samples in one run.


Full service - Library Preparation, Cluster Generation, and Sequencing:

At the current time, we only offer full service on genomic DNA. We will prepare a library from your genomic DNA, and perform cluster generation and sequencing.

Genomic DNA sample submission:
For each sample, a minimum of 5 micrograms of genomic DNA is required. The gDNA should be column purified and intact. An agarose gel picture is required and the A260:280 ratio needs to be above1.8.

Cluster Generation and Sequencing-only service:
We can perform sequencing on customer generated libraries, provided they are constructed in accordance with standard Illumina protocols. Sample preparation kits can be purchased from Illumina, and protocols are available on Illumina website (www.illumina.com). Currently, kits are available for genomic DNA, small RNA and gene expression applications. Please contact us to be sure you are ordering the proper kit for you application and research goals.

Pre-made library submission:
For each sample, 5ul of 100nM template is required. This is to make sure that we can accurately check the DNA concentration with NanoDrop. If you cannot provide templates at this concentration, then you need to provide minimum 5 ul of 10nM templates. In this case, however, you are responsible to make sure that the quantitation is accurate. Too high or two low template concentration might result in poor cluster generation and poor sequencing data.

The templates must be ~150-200bp including adapter/primer sequence. An agarose gel picture showing template size is required. A260:280 reading needs to be above 1.8.


Data Output and Delivery

A typical sequencing run generates 1-4 million reads per lane, with read length up to 35 bp. Currently, the standard outputs we generate are sequence files in FASTA and FASTQ formats with base-calling quality scores. We will deliver the files to users through either ELF (Exchange of Large Files) or CFS (RU Central File Store). FASTA/FASTQ files are about 1 GB for each lane.

An example of FASTA/FASTQ file is shown below:
FASTQ Line 1: Unique ID for a sequencing read
Line 2: Sequences
Line 3: Repeat of the ID (preceded with a + sign)
Line 4: Base calling quality score (Analogous to Phred scores)

@12_10_2007_SequencingRun_3_1_119_647
TTTGAATATATTGAGAAAATATGACCATTTTT
+12_10_2007_SequencingRun_3_1_119_647
40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 27 40 40 4 27 40

FASTA
Line 1: Unique ID for a sequencing read
Line 2: Sequences
No quality score info included in this format

>12_10_2007_SequencingRun_1_1_120_705
GTTTTGAATTTCACACGCTTTCAGAATTTAAT

Data Storage

Due to the huge size of image files, they can only be stored at the Genomics Resource Center for one month. If you want to store the image files for longer time, please provide us a hard drive of at least 150GB for one lane, or 1TB for a whole run (8 lanes).


Sample Preparation Protocols (as of October 27, 2008)
Please check Illumina website www.illumina.com for updates.

Preparing Samples for Digital Gene Expression-Tag Profiling with NlaIII
Preparing Samples for Digital Gene Expression-Tag Profiling with DpnII
Preparing Samples for Sequencing Genomic DNA
Preparing Samples for Analysis of Small RNA
Preparing Samples for ChIP Sequencing of DNA
Preparing Samples of Sequencing mRNA
Preparing Samples for Paired-End Sequencing